bobthefrog69 bobthefrog69
  • 04-05-2017
  • Biology
contestada

I need a sentence for relative dating.

Respuesta :

maesonmcdonough maesonmcdonough
  • 04-05-2017
Relative dating arranges geological events, the rocks they leave behind, in a sequence. 
Answer Link

Otras preguntas

The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
Where did middle names come from
p(x) x^3+x^2-x-1 Find all zeros of p (x)
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
How has water influenced the development of civilization in Africa