chl1orans0tha chl1orans0tha

04-02-2017
Mathematics

contestada

Lavonne sold 4 times as many raffle tickets as kenneth. lavonne sold 56 raffle tickets. how many tickets did kenneth sell?

Respuesta :

jemimahrowles jemimahrowles

04-02-2017

56÷4=14

Kenneth sold 14 tickets

Answer Link

massalayansu massalayansu

19-09-2018

14 is the answer. Just divide 56/4 and you get 14.

Answer Link

Otras preguntas

Which of the following are solutions to the equation below? Check all that apply. 4x2 - 81 = 0 A. 9 B.-9/2 C.-2/9 D.-9 E.9/2 F.2/9

Need help ASAP !!!!!!!

1. use the graph of y = sin θ to find the value of sin θ for each value of θ. 270°please help

What does President Lincoln express he did not want to do?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?

What was a major effect of the agricultural revolution in the united states during the late 1800's?

How far away is the next Earth-like planet in light years? What does this seem unlikely that it won’t be a manned space mission?

I just need a confirmation that my answer is right? Find side AC. Round to the nearest hundredth. The angles are: Angle A = 40°, Angle C = 90°, and Angle B = 50

Identify the consequences—both long-term and short-term—of the vietnam war.