laequity6896 laequity6896
  • 03-02-2022
  • Mathematics
contestada

Solve for x. −7. 8(x 6. 5)=−25. 74 Enter your answer, as a decimal, in the box. X =.

Respuesta :

krugers krugers
  • 03-02-2022

Answer:

x = -3.2

Step-by-step explanation:

Expand brackets

-7.8x - 50.7 = -25.74

Make x the subject of the equation by adding 50.7 on both sides

-7.8x = -25.74 + 50.7

-7.8x = 24.96

24.96/-7.8 = x

x = -3.2

Answer Link

Otras preguntas

what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
how can you write 0.45 as fraction and a percentage ,please show work
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
the bombing of Hiroshima and Nagasaki resulted in
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
what rule does static electricity follow
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
What was religion like in Shang China?