37ybutp5ym 37ybutp5ym
  • 03-02-2022
  • Mathematics
contestada

Help please!!!!!!!!!!!!!

Help please class=

Respuesta :

dwayneabartley681 dwayneabartley681
  • 03-02-2022
Answer= 13 _10= [23]_5
Please rewrite the same equation just put the 23 in the box
Answer Link

Otras preguntas

Pls answer this question
A child finds 30 nickels and dimes between sofa cushions. how many dimes did the child find if the total value of the coins is $1.90?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
help pls :) I am stuck on this chemistry question about percentage yields!
What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses
Which is the best way to conserve worldwide freshwater resources? 1.increase the amount of land used to raise cattle 2.use more efficient irrigation technique
A line with an underfined slope contains the point (8,3). The point (?, -4) is also on the line. What is the missing x-coordinate?
crystal lattice definition
Which country use tax brackets as part of their tax system? canada australia south africa all of the above?
Which of these hormones does not help control fluid balance during exercise?