shrihanleisha21 shrihanleisha21

01-10-2021
Physics

contestada

Compare the pressure exerted by the liquid at points A, B and C. Justify your answer

Compare the pressure exerted by the liquid at points A B and C Justify your answer class=

Respuesta :

himaruanuk himaruanuk

01-10-2021

Answer:

Pressure is equal in A, B, C and D

Explanation:

Pressure does not depends on the shape of the container

Pressure acting all direction

Answer Link

Otras preguntas

What caused the gross domestic product of the united states to quadruple between 1860 and 1890?

What’s the answer to #12? and why

While speaking with cassius, what military action does brutus want to take?

Lisa creates a scatter plot of the number of minutes she runs on the treadmill and the calories she burns. About how many more calories does she burn for every

Check the area that applies to a mesomorph body type. select one: a. trim waist b. trouble losing weight c. stoop-shouldered d. short heavy legs

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Observing people and asking them questions are the two principal ways to obtain

please help if you know, thanks!

what is x? using the picture below and directions

(60) Points HeLp asap 5 questions