CHRISTOPHERLEWIS322 CHRISTOPHERLEWIS322

04-03-2021
Mathematics

contestada

which decimal is equivalent to 2/3?

Respuesta :

Аноним Аноним

04-03-2021

Answer:

Answer is 0.666

Step-by-step explanation:

I hope it's helpful!

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Find the missing length indicated

Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in

what are the zeros of the polynomial x2+4x-12

Let f(x) = 2x + 2. Solve f−1(x) when x = 4. a. 1 b.3 c. 4 d.10

What is the area of this composed figure

At age 76 years, which chronic condition is elizabeth most likely to have?

From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.

An element's atomic number is 64. How many protons would an atom of this element have?

A newly formed country in the Caribbean has no high tariffs, yet other countries find it difficult to trade with the new country because of its requirements for