Sierrakv717 Sierrakv717

03-03-2021
Mathematics

contestada

EXTRA POINTS-- find the value of x and the measure of each angle

EXTRA POINTS find the value of x and the measure of each angle class=

Respuesta :

03-03-2021

Answer:

x= 25

3x-4=71

2x+3=53

2x+6=56

Step-by-step explanation:

Answer Link

Otras preguntas

if you work in an adolescent oncology youth cancer office will the doctor more likely see patients with Hodgkin lymphoma or neuroblastoma explain your answer

What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2

Does the increase in blood glucose levels increase the viscosity of the blood

punctuated equilibrium definition biology

Which of these sentences is punctuated correctly? Although the concert doesn't start for over an hour; most of the fans have already arrived at the concert hal

(50)points 5 questions

Yahaira is ready to reach the next level in her fitness. She is in great shape, but she still lacks the power needed to lift heavy objects. Which of the followi

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP!!!!!!!! Which of the following is a continuous random variable? A) the number of employees in an office B) the salaries of employees in an off

Identify the consequences—both long-term and short-term—of the vietnam war.