brandont9800 brandont9800

01-02-2021
Social Studies

contestada

HELP NOW PLEASEEEE
Now write a short journal entry or

Respuesta :

jordanpfuhl jordanpfuhl

05-02-2021

Answer:

This is a photo of a journal entry you can just copy down

Explanation:

Ver imagen jordanpfuhl

Answer Link

Otras preguntas

Why did Britain change its immigration policies regarding Palestine in 1939? - to improve its relationship with Germany - to protect its relationship with Arab

equation, an identity, or a contradiction. 7v+42=11(3v+8)−2(13v−1)

Rewrite the following expression without using absolute value. |√2+3-4|

When light passes at an angle from water into air, it A. bends away from the normal B. bends towards the normal C. does not bend D. is completely reflected

help please i’ll give brainliest

x-7>27 Sove the inequality and enter your solution as an inequality comparing the variable to a number

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

RNA polymerase from E. coli does not function at 0ºC, whereas in vitro experiments determined that RNA polymerase from Pseudomonas syringae strain Lz4W function

4. Different restriction enzymes cut the same DNA molecule into different numbers of fragments, because different restriction enzymes have a. different base pa

A horizontal spring with spring constant 750 N/m is attached to a wall. An athlete presses against the free end of the spring, compressing it 5.0 cm. How hard i