taylorupnick taylorupnick

03-11-2020
Mathematics

contestada

What is the length of the segment with endpoints (-3, 4) and (5,4)?
A) 2
B) 8
C) 16
D) 64

Respuesta :

charlieknecht charlieknecht

03-11-2020

B the answer is 8 trust me edg

Answer Link

Otras preguntas

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

Racing other drivers, tailgating, and attempting to beat a train to a railroad crossing are possible consequences of __________ when driving while impaired. A.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

3∙(a+x), if a=8; x=−10

a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?

an integer is one more than four times another. if the product of two integers is 39, then find the integers

As the mother of a late-maturing boy, betty is concerned because, when compared to early-maturing boys, late maturers are more likely to ________.

A patient in a hospital has been diagnosed with malaria, which is a disease transmitted through mosquito bites. Jamie has an itchy, red bump where she was bit

why is the inner mitochondrial membrane folded

Can someone Help me with that please