777jaydonnguyen 777jaydonnguyen
  • 04-06-2020
  • Mathematics
contestada

Find the volume of the pyramid.

Find the volume of the pyramid class=

Respuesta :

tsmoink21 tsmoink21
  • 04-06-2020

Answer:

The answer is 112 ft squared

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which type of intelligence allows people to use their vision to develop mental images?
If aspartame is successfully hydrolyzed, the products are methanol, phenylalanine and aspartic acid. what two functional groups must be hydrolyzed for this reac
Why is the answer for #6 A?
Which of these sentences is punctuated correctly? Although the concert doesn't start for over an hour; most of the fans have already arrived at the concert hal
A sharp type of pain from the abdomen that travels along neural routes
HELP NEEDED !!!! A class's exam scores are normally distributed. If the average score is 65 and the standard deviation is 6, what percentage of students scored
What law required Northerners to assist in the return of runaway slaves
Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in
The _______ was Franklin Roosevelt's program designed to fight the Great Depression