ashwinipokhrel8 ashwinipokhrel8

02-05-2020
Mathematics

contestada

a lot is 50 m by 38 m. A house 20 m by 8 m is built on the lot. How much area is left over ?

Respuesta :

hello6538 hello6538

02-05-2020

50 x 38 = 1,900

20 x 8 = 1,600

1900 - 1600 = 300

Final Answer:
300m of area is left.

Answer Link

Otras preguntas

100 points to whoever answers this question!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height (in meters) f

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

4/y+2 - 9/y-2 = 9/y^2-4

I really need help! 25 points and I'll give brainliest. Thanks! 1. Describe the main events and leaders of the Punic Wars. 2. Write a short paragraph that di

who invented the glass harmonica

[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of

Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron

The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa

Brainliest to most helpful! Answer asap! The point (−3, 1) is on the terminal side of angle θ, in standard position. What are the values of sine, cosine, and ta

What allows small vertical movements to grow until they produce turbulent airflow?