keyshla14 keyshla14
  • 01-04-2020
  • Mathematics
contestada

Factor completely 5a^2 +b

Respuesta :

skyliestarz
skyliestarz skyliestarz
  • 01-04-2020
no solution? That cannot be factored
Answer Link

Otras preguntas

What is Food Insecurity?
You pump 100 gas particles in Basketball A and 100 gas particles in Basketball B. both basketballs are at room temperature ¿Which basketball will be more firm?
Which formula best reflects the make-up of Congress?
How many digits will be in the quotient? 39) 4,641 1 digit 3 digits 2 digits 4 digits
Jane goes to an amusement park with her friends. The admission fee to the amusement park is $8 and each ride costs $2. If Kelly has only $32 to spend how many r
A bookstore had 60 copies of a magazine. Yesterday, it sold 1/4 of them. Today, it sold 2/3 of what remained. How many copies does the bookstore have left?
The ruling in Brown v Board of Education overturned which previous case? A. Tinker v Des Moines B. Marbury v Madison C. Plessy v Ferguson D. Miranda v Arizona
SOMEONE HELP QUICKLY
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
PLEASE HELP MEEEEEE!!!!! I literally have to get this done