xengvang9926 xengvang9926

01-06-2019
Health

contestada

What is the term generally used to describe the way you present yourself to others?

(fill in the blank)

Respuesta :

DestinyLovesSchool DestinyLovesSchool

01-06-2019

Hello! :)
Your demeanor is defined as being either your facial appearance or your behavior.
Hope this helped and I hope I answered in time!
Good luck!
~ Destiny ^_^

Answer Link

Otras preguntas

a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?

does radiation need a phase of matter to travel with?

what is the most common type of vegetation throughout Latin America

The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?

what is the geometric mean between 6 and 20?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.

What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?

Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D