fishgirl fishgirl
  • 03-08-2018
  • Mathematics
contestada

I need help on this question plz answer me fast

I need help on this question plz answer me fast class=

Respuesta :

Swagduck343 Swagduck343
  • 03-08-2018
it would be the first one
Answer Link

Otras preguntas

Please help me guys I will give brainliest to right answers "The Fall of the House of Usher" Part A: what does the term "simulate" most likely mean, as used in
plz help*My name is Jackie. I am five feet, three inches tall. I am interested in riding a bike to work. The distance is eight miles, with four being on a busy
The cost to replace a water pump in a sports car was $483. This included $305 for the water pump and $89 per hour for labor. How many hours of labor were requir
What is the slope and y-intercept of this graph?​
Which statement best compares the Middle English and modern English versions of the text?
what is the relationship between the temporary party organizations and the permanent party organizations?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
so i falling behind in math can some pls help me pls pls pls
There are 2 parts to the names of each type of air mass. Explain what the first part tells you about the air mass, and explain what the second part tells you ab
Please help and explain your reasoning!Here is the image: Thanks!